The Introduction of NeoR and KanR

The protein name of KanR is Aminoglycoside 3'-phosphotransferase. It is from Brucella abortus. The expression of KanR is under the control of a prokaryotic promoter not active in eukaryotes. NeoR’s protein name is also Aminoglycoside 3'-phosphotransferase. But it is from Salmonella enterica subsp. enterica serovar Heidelberg and active in eukaryotes (UniProt).

Here is a part named NeoR – KanR on MolecularCloud. The information as follows:


Part Name: NeoR - KanR

Description: Aminoglycoside phosphotransferase from Tn5 confers resistance to kanamycin in bacteria, or neomycin and G418 (Geneticin(R)) in eukarytoes.

Size (bp): 795

Sequence

ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC

TATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCC

GGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGC

CCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGC

GTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGC

TATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG

AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACC

TGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGA

AGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAG

CCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGT

GACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGG

ATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGG

CTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTG

CTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGAC

GAGTTCTTCTGA

Find more plasmids and parts   here.


Reply

About Us · User Accounts and Benefits · Privacy Policy · Management Center · FAQs
© 2020 MolecularCloud