A manual for the prime editing vectors

Introduction of the prime editing vectors developed in Chen Lab

Recently, a novel, universal, and precise genome-editing technology named prime editing was developed (Anzalone et al. Nature. 2019, 576: 149–57). We generated a set of pGreen3 binary vectors for prime editing in monocot plants (Jiang et al. Genome Biology. 2020, 21: 257). These vectors can be used to assemble pegRNAs by BsaI-based Golden Gate cloning, which results in the generation of final prime editors (Figure 1). The pGreen3-based prime editors and the virulence helper pVS1-VIR2 (MC_0068761) are able to constitute a ternary vector system (Zhang et al. Plant Physiology. 2019, 181: 1441–8) for prime editing in a variety of monocot plants.

Figure 1. Structures of the prime editing vectors developed in Chen Lab

Cat. No.

Plasmid Name

MC_0101213

pG3H-PE2-35C

MC_0101214

pG3H-PE2-U3A.2

MC_0101215

pG3GB-PE2-35C

MC_0101216

pG3GB-PE2-U3A.2

MC_0101217

pG3B-PE2-35C







A manual for the prime editing vectors

Simplified protocol of assembly of pegRNA cassettes

1.         Search for target sites using dedicated websites, such as Tefor (http://crispor.tefor.net/). Select those targets with high scores of specificity and editing efficiency. Design rtT-PBS sequences of pegRNAs and replace the corresponding sequences in 2xpegR or 2xpegR.U3 (See below) with the designed guide and rtT-PBS sequences. Submit the designed 2xpegR or 2xpegR.U3 for synthesis. The two pegRNAs can be the same to enhance pegRNA expression.  


2.         Set up Golden Gate reactions as follows:

Component

 Volume

Reaction conditions

Vectors with synthetic fragments (~100 ng/μl)

 2 μl

5 hours at 37°C

5 min at 50°C

10 min at 80°C

Note: It is essential to use a High Concentration (HC) Ligase (2 million units/ml, NEB)

Prime editing vectors (~100 ng/μl)

 2 μl

10× T4 DNA Ligase Buffer (NEB)

 1.5 μl

10× BSA

 1.5 μl

BsaI (NEB)

 1 μl

T4 DNA Ligase (HC, NEB)

 1 μl

ddH2O

 6 μl

Total volume

 15 μl

3.         Transform E.coli competent cells with 5 μl of reaction mixture, and select positive clones on kanamycin LB agar plates.

4.         Identify correct clones by colony PCR with primers tGly-IDF2 and tMet-IDR2 and verify them by digestion with HindIII and SpeI.

5.         Introduce the prime editors into the engineered Agrobacterium strain LBA4404/pVS1-VIR2 (MC_0068761) or EHA105/pVS1-SAH2 (MC_0068762), and use the strains to transform monocot plants.

Sequence of synthetic 2xpegR inserted into the 35C cloning cassette

BsaI-Spacer-sgR-rtT-PBS-HDV-tMet-Spacer-sgR-rtT-PBS-BsaI

GGTCTCATGCANNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA

AAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCC

GGCTGGGCAACATGCTTCGGCATGGCGAATGGGACAACAACAAATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAG

GTCCCAGGATCGAAACCTGGCTCTGATANNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG

TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAGAGACC

Length: 420-bp

Sequence of a two-pegRNA expression cassette derived from the 35C cassette

35S-CmYLCV-U6-tGly-Spacer-sgR-rtT-PBS-HDV-tMet-Spacer-sgR-rtT-PBS-HDV-polyT-HSPt

ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGAC

AAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCA

ATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAA

GGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACC

CCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATTGGCAGACATACTGTCC

CACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTG

GTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATG

TGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTC

AGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAG

AAGTAGTCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGACGACGAAAACAGGTAAGAGCTAAGCATCTAG

ATAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGATT

GAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCANNNNNNN

NNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG

GTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCT

TCGGCATGGCGAATGGGACAACAACAAATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGTCCCAGGATCGAA

ACCTGGCTCTGATANNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC

TTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGC

TGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTTTTTTTTGATATCTCCGGGGCTAA

TTGAATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTGGTGTGCTTAAG

TTTGTGTTTTTTTCTTGGCTTGTTGTGTTAT

GAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATGTTTCTATAATCCATTGTGAATGTTTTGTTGG

ATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATTAAAGATAAG

Note:

1.         The underlined part comes from the synthetic fragment while the rest come from the binary vectors, such as pG3H/GB/B-PE2-35U6.

2.         Primer sequences are as follows:

tGly-IDF2: GCACCAGTGGTCTAGTGGTAGAATA

tMet-IDR2: TATCAGAGCCAGGTTTCGATCCT

(tGly-IDF2 + tMet-IDR2 = ~344 bp)

3.         When prime editors are digested with HindIII and SpeI, a 1.8 kb fragment will be cut off.

Synthetic 2xpegR.U3 inserted into the U3 cloning cassette

BsaI-Spacer-sgR-rtT-PBS-HDV-OsU3t-TaU3p-tMet-Spacer-sgR-rtT-PBS-BsaI

GGTCTCATGCANNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA

AAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGC

CGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTTTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATT

TTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAACATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAA

GGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCA

GGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGA

ACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAG

CCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAG

TCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAG

CAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCGAACAACAAATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAAC

CCACAGGTCCCAGGATCGAAACCTGGCTCTGATANNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA

GGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAGAGACC

Length: 1048-bp

Sequence of two pegRNA expression cassettes derived from the U3 cassette

OsU3p-tGly-Spacer-sgR-rtT-PBS-HDV-OsU3t-TaU3p-tMet-Spacer-sgR-rtT-PBS-HDV-TaU3t

AGTAATTCATCCAGGTCACCAAGTTCTAGGATTTTCAGAACTGCAACTTATTTTATCAAGGAATCTTTAAACATACGAACAGATCACTTAAA

GTTCTTCTGAAGCAACTTAAAGTTATCAGGCTTGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCG

TCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGATGTGAAGAAGTAAGATAAACTGT

AGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAACA

AAGTCTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGATTTAAAAGAGTTGTGCAGATGATCCGTGGCAACAAAGCACCA

GTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCANNNNNNNNNNNNNNNNNNNN

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACT

TTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGC

GTGTTCAACATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTG

TCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGA

AATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGG

AAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGC

AGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGC

ACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCGAACAACAAATC

AGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGTCCCAGGATCGAAACCTGGCTCTGATANNNNNNNNNNNNNNNNN

NNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC

TTTTTTTTTTGTCCTTCTGTTTTTTTAGTCAGTCTCTTTTTTCAGAAGTACAACATCTT

Note:

1.         The underlined part comes from the synthetic fragment while the rest comes from the binary vectors, such as pG3H/GB/B-PE2-35U6.

2.         Primer sequences are as follows:

tGly-IDF2: GCACCAGTGGTCTAGTGGTAGAATA

tMet-IDR2: TATCAGAGCCAGGTTTCGATCCT

(tGly-IDF2 + tMet-IDR2 = ~972 bp)

3.         When prime editors are digested with HindIII and SpeI, a 1.7 kb fragment will be cut off.

References

Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR: Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 2019, 576:149-157.

Jiang YY, Chai YP, Lu MH, Han XL, Lin Q, Zhang Y, Zhang Q, Zhou Y, Wang XC, Gao C, Chen QJ: Prime editing efficiently generates W542L and S621I double mutations in two ALS genes in maize. Genome Biol 2020, 21:257.

Zhang Q, Zhang Y, Lu MH, Chai YP, Jiang YY, Zhou Y, Wang XC, Chen QJ: A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol 2019, 181:1441-1448.


Reply

About Us · User Accounts and Benefits · Privacy Policy · Management Center · FAQs
© 2020 MolecularCloud