pUC57-2019-nCoV-PC:N plasmid from GenScript Biotech
pUC57-2019-nCoV-PC:N
Cat. No.:
MC_0101077
Availability:
5 μg of lyophilized plasmid
Price:
$85
| Keywords | Cloning |
| Vector Backbone | pUC57 |
| Source | |
| Depositor | GenScript Biotech |
| Organization | GenScript Biotech |
| Description | This plasmid contains part of 2019-nCoV(SARS-CoV-2) N gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR |
| Publication |
| Plasmid Copy | High Copy |
| Bacterial Resistance | Ampicillin |
| Growth Strain | TOP10 |
| Growth Temperature | 37°C |
| Plasmid Size (bp) | 3089 |
| Gene/Insert Name | N gene |
| Gene/Insert Sequence |
cacccgcaatcctgctaacaatgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagaagggagcagaggcggcagtcaagcctcttctcgttcctcatcacgtagtcgcaacagttcaagaaattcaactccaggcagcagtaggggaacttctcctgctagaatggctggcaatggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttgagagcaaaatgtctggtaaaggccaacaacaacaaggccaaactgtcactaagaaatctgctgctgaggcttctaagaagcctcggcaaaaacgtactgccactaaagcatacaatgtaacacaagct |
*This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.
Customers who viewed this item also viewed:
CRISPR
CRISPR
Constitutive expression of Cas9 together with inducible expression of lambda RED and sgR
CRISPR/Cas9-assisted gRNA-free one-step genome editing