pUC-23-FBAin plasmid from Tian-Qiong Shi

   Sequence by GenScript        Sequence by Depositor

pUC-23-FBAin

Cat. No.:
MC_0101302
Availability:
4 µg of lyophilized plasmid
(1 µg for low-copy plasmid)
Price:
$65
  • General
  • Specification
  • Comments (0)
  • Keywords Cloning
    Vector Backbone pUC57-T7-FCC1
    Source He Huang Lab
    Depositor Tian-Qiong Shi
    Organization Nanjing Normal University
    Description bsaI-2-FBAin-3-bsaI
    Publication Li YW, Yang CL, Shen Q, Peng QQ, Guo Q, Nie ZK, Sun XM, Shi TQ, Ji XJ, Huang H. YALIcloneNHEJ: An Efficient Modular Cloning Toolkit for NHEJ Integration of Multigene Pathway and Terpenoid Production in Yarrowia lipolytica[J]. Front Bioeng Biotechnol. 2022, 9:816997
    Plasmid Copy High Copy
    Bacterial Resistance Ampicillin
    Growth Strain DH5-Alpha
    Growth Temperature 37°C
    Plasmid Size (bp) 3798
    Gene/Insert Name 23-FBAin
    Gene/Insert Sequence

    GGTCTCCGAGTGTACGTAGCAACAACAGTGTACGCAGTACTATAGAGGAACAATTGCCCCGGAGAAGACGGCCAGGCCGCCTAGATGACAAATTCAACAACTCACAGCTGACTTTCTGCCATTGCCACTAGGGGGGGGCCTTTTTATATGGCCAAGCCAAGCTCTCCACGTCGGTTGGGCTGCACCCAACAATAAATGGGTAGGGTTGCACCAACAAAGGGATGGGATGGGGGGTAGAAGATACGAGGATAACGGGGCTCAATGGCACAAATAAGAACGAATACTGCCATTAAGACTCGTGATCCAGCGACTGACACCATTGCATCATCTAAGGGCCTCAAAACTACCTCGGAACTGCTGCGCTGATCTGGACACCACAGAGGTTCCGAGCACTTTAGGTTGCACCAAATGTCCCACCAGGTGCAGGCAGAAAACGCTGGAACAGCGTGTACAGTTTGTCTTAGCAAAAAGTGAAGGCGCTGAGGTCGAGCAGGGTGGTGTGACTTGTTATAGCCTTTAGAGCTGCGAAAGCGCGTATGGATTTGGCTCATCAGGCCAGATTGAGGGTCTGTGGACACATGTCATGTTAGTGTACTTCAATCGCCCCCTGGATATAGCCCCGACAATAGGCCGTGGCCTCATTTTTTTGCCTTCCGCACATTTCCATTGCTCGGTACCCACACCTTGCTTCTCCTGCACTTGCCAACCTTAATACTGGTTTACATTGACCAACATCTTACAAGCGGGGGGCTTGTCTAGGGTATATATAAACAGTGGCTCTCCCAATCGGTTGCCAGTCTCTTTTTTCCTTTCTTTCCCCACAGATTCGAAATCTAAACTACACATCACACAATGCCTGTTACTGACGTCCTTAAGCGAAAGTCCGGTGTCATCGTCGGCGACGATGTCCGAGCCGTGAGTATCCACGACAAGATCAGTGTCGAGACGACGCGTTTTGTGTAATGACACAATCCGAAAGTCGCTAGCAACACACACTCTCTACACAAACTAACCCAGCTCTTCGCAGCGAGACC

    *This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.
    Customers who viewed this item also viewed:

    pCas

    Constitutive expression of Cas9 together with inducible expression of lambda RED and sgR

    pCAGO

    CRISPR/Cas9-assisted gRNA-free one-step genome editing

    pUC57-2019-nCoV-PC:RdRP

    This plasmid contains part of 2019-nCoV(SARS-CoV-2) RdRP gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

    pUC57-2019-nCoV-S(Original)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (original sequence)

    pUC57-2019-nCoV-S(Human)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Human expression system)

    pUC57-2019-nCoV-N

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) nucleocapsid phosphoprotein (original sequence)

    pcDNA3.1+/C-(K)DYK-ACE2 (NM_021804.2, OHu20260)

    Homo sapiens angiotensin I converting enzyme 2 (ACE2), the receptor for 2019-nCoV(SARS-CoV-2).

    2019-nCov_pcDNA3.1(+)-P2A-eGFP

    The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
    #[first_name]
    #[create_date]
    #[comment]
    Reply(#[reply_num])
    #[like_num]
  • #[first_name]
    #[create_date]
    #[comment]
    Reply
    #[like_num]