gRNA and WT SpCas9 co-expression plasmid: pLentiCRISPR v2 DNMT1

   Reference Sequence     View the backbone

pLentiCRISPR v2 DNMT1

Cat. No.:
MC_0055279
Availability:
4 µg of lyophilized plasmid
(1 µg for low-copy plasmid)
Price:
$99
  • General
  • Specification
  • Comments (0)
  • Keywords CRISPR
    Gene Targeted DNMT1
    Gene Target Sequence CTAGACGTCCATTCACTTCC
    Species H. sapiens (human)
    Description The following gRNA sequence is designed by Feng Zhang’s laboratory at the Broad institute to uniquely target the indicated gene within the human genome. The gRNA sequence is for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. The sgRNA sequence was validated by Feng Zhang’s research.
    Vector Backbone pLentiCRISPR v2
    Selectable Marker Puromycin
    Reference Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods (2014) 11(8): 783-4.
    Plasmid Copy High Copy
    Bacterial Resistance Ampicillin
    Growth Strain Stbl3
    Growth Temperature 37°C
    Plasmid Size (bp) 13013
    Gene/Insert Name DNMT1
    Gene/Insert Sequence

    CTAGACGTCCATTCACTTCC

    Customers who viewed this item also viewed:

    pLentiCRISPR v2 DNMT1

    The following gRNA sequence is designed by Feng Zhang’s laboratory at the Broad institute to uniquely target the indicated gene within the human genome. The gRNA sequence is for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. The sgRNA sequence was validated by Feng Zhang’s research.

    pLentiCRISPR v2 DNMT3B

    The following gRNA sequence is designed by Feng Zhang’s laboratory at the Broad institute to uniquely target the indicated gene within the human genome. The gRNA sequence is for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. The sgRNA sequence was validated by Feng Zhang’s research.
    #[first_name]
    #[create_date]
    #[comment]
    Reply(#[reply_num])
    #[like_num]
  • #[first_name]
    #[create_date]
    #[comment]
    Reply
    #[like_num]