pCas9g10 plasmid from Tamás Fehér
pCas9g10
Cat. No.:
MC_0000792
Availability:
4 µg of lyophilized plasmid
(1 µg for low-copy plasmid)
(1 µg for low-copy plasmid)
Price:
$65
| Keywords | CRISPR |
| Vector Backbone | pCas9 |
| Source | Member Deposit |
| Depositor | Tamás Fehér |
| Organization | Biological Research Centre (BRC), Hungarian Academy of Sciences |
| Description | CRISPR |
| Publication | Christian Møller-Olsen, Siu Fung Stanley Ho, Ranti Dev Shukla, Tamas Feher & Antonia P. Sagona: Engineered K1F bacteriophages kill intracellular Escherichia coli K1 in human epithelial cells. Scientific Reports 8 , 1–18 |
| Plasmid Copy | High Copy |
| Bacterial Resistance | Chloramphenicol |
| Growth Strain | DH5-Alpha |
| Growth Temperature | 37°C |
| Plasmid Size (bp) | 9326 |
| Gene/Insert Name | g10 spacer |
| Gene/Insert Sequence |
agcggagtaagcacttttagccaacctaac |
*This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.
Customers who viewed this item also viewed:
CRISPR
CRISPR
Constitutive expression of Cas9 together with inducible expression of lambda RED and sgR
CRISPR/Cas9-assisted gRNA-free one-step genome editing