ClyA RR plasmid from Shuo Huang

   Sequence by GenScript        Sequence by Depositor

ClyA RR

Cat. No.:
MC_0068760
Availability:
4 µg of lyophilized plasmid
(1 µg for low-copy plasmid)
Price:
$65
  • General
  • Specification
  • Comments (0)
  • Keywords Other
    Vector Backbone pET-30a(+)
    Source Member Deposit
    Depositor Shuo Huang
    Organization Nanjing University
    Description The plasmid ClyA-RR is designed for the preparation of a mutant Cytolysin A (ClyA). ClyA is a pore-forming toxin which was found in various E. coli strains. Its structure has been characterized using X-ray crystallography (PDB: 2WCD).With a unique wide aperture, ClyA along with its mutants have been used as nanopore sensors for the detection of macromolecules. The ClyA-RR mutant is engineered for more efficient DNA sensing (Franceschini L, Brouns T, Willems K. et al. DNA Translocation through Nanopores at Physiological Ionic Strengths Requires Precise Nanoscale Engineering. ACS Nano 2016, 10(9): 8394-8402). It is also a highly compatible sensor for the imaging based DiffusiOptoPhysiology platform (Wang Y, Wang Y, Du X, et al. Electrode-free nanopore sensing by DiffusiOptoPhysiology[J]. Science Advances, 2019, 5(9): eaar3309.)
    Publication Wang Y, Wang Y, Du X, et al. Electrode-free nanopore sensing by DiffusiOptoPhysiology[J]. Science Advances, 2019, 5(9): eaar3309
    Plasmid Copy Low Copy
    Bacterial Resistance Kanamycin
    Growth Strain TOP10
    Growth Temperature 37°C
    Plasmid Size (bp) 6183
    Gene/Insert Name (ClyA RR)_PET-30a(+)
    Gene/Insert Sequence

    CATATGACAGGAATATTTGCAGAACAAACTGTAGAAGTAGTTAAATCAGCTATTGAGACCGCGGATGGTGCGCTGGACCTGTATAACAAGTACCTGGACCAGGTGATCCCGTGGAAGACCTTCGATGAAACCATTAAGGAACTGAGCCGTTTTAAACAGGAGTATAGCCAAGAAGCGAGCGTGCTGGTTGGTCGTATCAAGGTGCTGCTGATGGACAGCCAGGATAAATACTTCGAGGCGACCCAAACCGTTTATGAATGGGCGGGTGTGGTTACCCAGCTGCTGAGCGCGTACATTCAACTGTTTGACGGCTATAACGAGAAGAAAGCGCGTGCGCAGAAAGATATCCTGATTCGTATCCTGGACGATGGTGTTAAGAAACTGAACGAAGCGCAGAAGAGCCTGCTGACCAGCAGCCAAAGCTTCAACAACGCGAGCGGCAAACTGCTGGCGCTGGACAGCCAACTGACCAACGATTTTAGCGAGAAGAGCAGCTACTATCAGAGCCAAGTGGACCGTATCCGTAAAGAAGCGTACGCGGGTGCGGCGGCGGGTATTGTTGCGGGTCCGTTCGGCCTGATCATTAGCTATAGCATCGCGGCGGGTGTGGTTGAGGGCAAGCTGATTCCGGAACTGAACAACCGTCTGAAAACCGTGCAGAACTTCTTTACCAGCCTGAGCGCGACCGTTAAGCAAGCGAACAAAGACATCGATGCGGCGAAGCTGAAACTGGCGACCGAGATTGCGGCGATCGGCGAAATTAAGACCGAAACCGAAACCACCCGTTTTTACGTGGATTATGACGATCTGATGCTGAGCCTGCTGAAGGGTGCGGCGAAGAAAATGATCAACACCAGCAACGAGTACCAGCAACGTCACGGCCGTAAGACCCTGTTTGAGGTTCCGGACGTGGGTAGCAGCTATCATCATCATCATCATCATTAATGACTCGAG

    *This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.
    Customers who viewed this item also viewed:

    pCas

    Constitutive expression of Cas9 together with inducible expression of lambda RED and sgR

    pCAGO

    CRISPR/Cas9-assisted gRNA-free one-step genome editing

    pUC57-2019-nCoV-PC:RdRP

    This plasmid contains part of 2019-nCoV(SARS-CoV-2) RdRP gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

    pUC57-2019-nCoV-S(Original)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (original sequence)

    pUC57-2019-nCoV-S(Human)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Human expression system)

    pUC57-2019-nCoV-N

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) nucleocapsid phosphoprotein (original sequence)

    pcDNA3.1+/C-(K)DYK-ACE2 (NM_021804.2, OHu20260)

    Homo sapiens angiotensin I converting enzyme 2 (ACE2), the receptor for 2019-nCoV(SARS-CoV-2).

    2019-nCov_pcDNA3.1(+)-P2A-eGFP

    The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
    #[first_name]
    #[create_date]
    #[comment]
    Reply(#[reply_num])
    #[like_num]
  • #[first_name]
    #[create_date]
    #[comment]
    Reply
    #[like_num]