pcDNA3.1(+)-P2A-eGFP-ORF3a plasmid from GenScript Biotech

   Sequence by GenScript        Sequence by Depositor

pcDNA3.1(+)-P2A-eGFP-ORF3a

Cat. No.:
MC_0101132
Availability:
5 μg of lyophilized plasmid
Price:
$140
  • General
  • Specification
  • Comments (0)
  • Keywords Expression
    Vector Backbone pcDNA3.1(+)-P2A-eGFP
    Source deposit
    Depositor GenScript Biotech
    Organization GenScript Biotech
    Description The plasmid is used for SARS-CoV-2 ORF3a protein expression. The ORF3a protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
    Publication
    Plasmid Copy High Copy
    Bacterial Resistance Ampicillin
    Growth Strain DH5-Alpha
    Growth Temperature 37°C
    Plasmid Size (bp) 6955
    Gene/Insert Name ORF3a
    Gene/Insert Sequence

    ATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAATAATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGCATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACAAGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTG

    *This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.
    Customers who viewed this item also viewed:

    pUC57-2019-nCoV-PC:RdRP

    This plasmid contains part of 2019-nCoV(SARS-CoV-2) RdRP gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

    pUC57-2019-nCoV-PC:ORF1ab

    This plasmid contains part of 2019-nCoV(SARS-CoV-2) ORF1ab and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

    pUC57-2019-nCoV-S(Human)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Human expression system)

    pUC57-2019-nCoV-S(Insect)

    This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Insect expression system)

    pcDNA3.1+/C-(K)DYK-ACE2 (NM_021804.2, OHu20260)

    Homo sapiens angiotensin I converting enzyme 2 (ACE2), the receptor for 2019-nCoV(SARS-CoV-2).

    2019-nCov_pcDNA3.1(+)-P2A-eGFP

    The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

    2019-nCov-Linker_pcDNA3.1(+)-C-eGFP

    The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through linker, which can be used for flow cytometry antibody screening.

    pcDNA3.1(+)-P2A-eGFP-ORF10

    The plasmid is used for SARS-CoV-2 ORF10 protein expression. The ORF10 protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

    pcDNA3.1(+)-P2A-eGFP-ORF6

    The plasmid is used for SARS-CoV-2 ORF6 protein expression. The ORF6 protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

    pcDNA3.1(+)-P2A-eGFP-E Protein

    The plasmid is used for SARS-CoV-2 envelope protein protein expression. The envelope protein n is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
    #[first_name]
    #[create_date]
    #[comment]
    Reply(#[reply_num])
    #[like_num]
  • #[first_name]
    #[create_date]
    #[comment]
    Reply
    #[like_num]