pLentiCRISPR v2 GNA12 is a gRNA and WT SpCas9 co-expression plasmid that targets the GNA12 gene of human genome.

gRNA and WT SpCas9 co-expression plasmid: pLentiCRISPR v2 GNA12

Reference Sequence View the backbone

pLentiCRISPR v2 GNA12

Cat. No.:

MC_0057067

Availability:

4 µg of lyophilized plasmid
(1 µg for low-copy plasmid)

Price:

$99

General

Specification

Comments (0)

Keywords	CRISPR
Gene Targeted	GNA12
Gene Target Sequence	ACGTGATCCCGTCGAAGCAC
Species	H. sapiens (human)
Description	The following gRNA sequence is designed by Feng Zhang’s laboratory at the Broad institute to uniquely target the indicated gene within the human genome. The gRNA sequence is for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. The sgRNA sequence was validated by Feng Zhang’s research.
Vector Backbone	pLentiCRISPR v2
Selectable Marker	Puromycin
Reference	Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods (2014) 11(8): 783-4.

Plasmid Copy	High Copy
Bacterial Resistance	Ampicillin
Growth Strain	Stbl3
Growth Temperature	37°C
Plasmid Size (bp)	13013
Gene/Insert Name	GNA12
Gene/Insert Sequence	ACGTGATCCCGTCGAAGCAC

Customers who viewed this item also viewed:

pLentiCRISPR v2 CCL28

The following gRNA sequence is designed by Feng Zhang’s laboratory at the Broad institute to uniquely target the indicated gene within the human genome. The gRNA sequence is for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. The sgRNA sequence was validated by Feng Zhang’s research.

pLentiCRISPR v2 GNA12